Qué es programar en informática

El sector económico que más ha crecido en las últimas décadas ha sido el de la informática.

Por lo tanto, crece de la mano, la importancia del sector del desarrollo de programas con cientos de miles de aplicaciones y software para poder usar todos los nuevos dispositivos que van surgiendo.

Que vas a encontrar aqui: Vas a entender lo que es programar en informática. Que utilizan para hacerlo, cuales son los lenguajes más populares y cuales son todos los tipos de programación.

Nos hemos acostumbrado tanto a utilizar software en nuestro día a día, que la mayoría de los usuarios sufren de una gran dependencia del software.

La tecnología y el software son herramientas que mejoran en muchas formas nuestra vida diaria, y usados de la manera correcta, pueden convertirse en nuestros mejores aliados.

Todos estos programas, también llamados aplicaciones o en forma más general software, deben ser obviamente pensados y desarrollados antes que el usuario pueda disfrutarlo en su dispositivo, una tarea que es llevada a cabo por el programador, un profesional que en los últimos años pasó de desarrollar en centros de investigación al ámbito de las grandes empresas y luego a desarrollar programas en distintas áreas de la economía productiva, convirtiéndose en el proceso en uno de los recursos humanos más buscados.

Como podemos el software en estos días es el elemento fundamental para que la tecnología pueda ocupar su sitio, y el programador el profesional que es capaz de darle forma a las necesidades de los usuarios. Si quieres saber más acerca de los programas, los programadores y la programación, en este post encontrarás todo lo que necesitas para entender este fascinante mundo.

Índice de Contenidos

    Qué es programar?

    Como mencionamos más arriba, detrás de todo el software que usamos cada día existe un concienzudo proceso de desarrollo y pruebas para poder crear y lanzar al mercado un programa de cualquier tipo. Este proceso es llamado programación, tarea que muchos consideran como un arte, y es fundamental para el tipo de sociedad en la que estamos inmersos hoy.

    Básicamente, a través de la programación podemos establecer paso por paso y mediante un determinado código, las funciones que tendrá un programa y cómo deberá procesar dicho código la computadora. Para ello, se utiliza un lenguaje de programación, del cual hablaremos más adelante. Lo que hagamos en el software de lenguaje luego de un determinado proceso se convertirá en un programa informático.

    Esta programación debe estar guiada por órdenes, instrucciones y expresiones, las que en su conjunto se asemejan a un lenguaje muy básico, por este motivo el software que usamos para crear programas es llamado lenguaje de programación.

    Esta programación se lleva a cabo mediante la implementación de determinados algoritmos, de los cuales también hablaremos más adelante, que por ahora explicaremos básicamente como un conjunto de reglas específicas que deber ser llevadas a cabo paso por paso para alcanzar un cierto objetivo.

    La informática, como ya lo hemos expresado, ocupa un lugar de gran importancia en la sociedad moderna, y es por ello que debemos aprender, aunque sea mínimamente, cuáles son sus características. Esto es básicamente por dos motivos: El primero de estos motivos es entender con mayor profundidad los procesos que se llevan a cabo en nuestros dispositivos, lo que nos permitiría poder solucionar todo tipo de problemas con mayor facilidad, y además nos permitiría mejorar el modo en cómo razonamos de manera lógica.

    El segundo motivo para aprender programación en que la informática puede ser un ámbito laboral muy importante, y la programación puede ser una salida laboral más que interesante, debido fundamentalmente a que la programación no es una carrera que sea para todos, es decir que te deben gustar los números y las estructuras, por este motivo la mayoría de las veces este ámbito está restringido a quienes son buenos en áreas como las matemáticas.

    Además siempre existirá la necesidad de un programador, tanto para grandes proyectos como para pequeños, lo que significa que existirán oportunidades de trabajo muy interesantes, las cuales son muy bien pagas.

    Para qué sirve programar?

    Programar básicamente se trata de crear software utilizando programas para crear programas (IDEs), utilizando un lenguaje de programación, con el objetivo cubrir las necesidades informáticas de quienes necesiten solucionar un problema o implementar características nuevas en una organización, empresa o hasta incluso clientes particulares.

    Aprender a programar software y hacerlo bien, es un arte, ya que además de combinar nuestra destreza con números y todas clase de operaciones matemáticas, también deberemos usar nuestra creatividad, inteligencia e ingenio para hacer que nuestro cliente encuentre lo que necesite en el programa que estamos desarrollando, y además se sienta cómodo al hacerlo.

    A pesar de lo fácil u obvio que parece entender qué es la programación o para qué sirve programar, lo cierto es que todavía muchas personas no tienen en claro ninguno de los dos conceptos. Para ayudar a comprender lo que significa cuáles son los alcances de ambas ideas, a partir de este punto encontraremos información que nos será muy útil para entender con claridad estos temas.

    Como sabemos, una computadora es un dispositivo electrónico increíblemente potente que puede llevar a cabo todo tipo de tareas. Sin embargo, es incapaz de hacer nada si no se le carga y hace correr un programa, es decir que una computadora sin programar tiene el mismo valor en términos de conocimientos que una licuadora u otro electrodoméstico.

    Esto significa que toda la potencia escondida en los discos duros, en la memoria RAM o en el procesador de la computadora se encuentra a la espera que un programador le proporcione instrucciones para ejecutar, lo que se hace a través de un lenguaje de programación.

    Entonces podría decirse que programar es definir determinadas instrucciones en un orden concreto para que sean ejecutadas por una computadora y de este modo obtener un cierto resultado. Con estas instrucciones sueltas se crea un conjunto de reglas de comportamiento, llamado programa.

    En respuesta a la pregunta ... ¿Para qué sirve programar?, la mejor respuesta que podemos dar, es “Para todo”.

    Aunque parezca un poco ambigua la respuesta, tenemos que tener en cuenta, y esto es muy relevante, que las computadoras y dispositivos electrónicos son usados por miles de millones de usuarios en todo el mundo, es decir que se encargan y nos asisten en muchas de las tareas que realizamos todos los días, lo cual sería muy largo de enumerar.

    Los dispositivos electrónicos están en todas partes; en la industria, el comercio, el entretenimiento, la cultura, la enseñanza y muchos ámbitos más, y ya son parte de la vida humana a un punto en que nos sería muy difícil desprendernos de sus funciones. Sin duda alguna, un campo fértil para programadores bien preparados.

    Por qué deberías aprender a programar?

    La mejor respuesta a este interrogante se encuentra precisamente un poco más arriba en este mismo artículo. Sin embargo, también existen otras necesidades que cubrir por las cuales aprender a programar desde cero es una de las mejores ideas que podemos tener con vistas a futuro.

    La programación con el paso de los años se ha convertido en una especialidad cada vez mejor cotizada, debido fundamentalmente a que la tecnología avanza y se expande, y con ella la necesidad de contar con profesionales que sean capaces de crear aplicaciones con las cuales poder utilizar y sacarle provecho a estos desarrollos de hardware.

    En este sentido, el desarrollo económico del programador ha crecido exponencialmente, y nunca fue tan renumerado como ahora, ya que con cada año que pasa crecen las oportunidades de empleo en el sector, multiplicándose por cada nueva tecnología que se crea o desarrolla. Aprender a desarrollar software en la actualidad es realmente muy lucrativo.

    Pero además de la posibilidad que la programación de software se convierta en una excelente fuente de ingresos, también aprender a programar es aprender a pensar, ya que la estructura y organización de los lenguajes de programación también nos permitirá afrontar nuestros problemas de manera mucho más certera, gracias a razonar de forma lógica, es decir paso a paso y evaluando cada situación por separado.

    Si bien lo siguiente que vamos a mencionar puede tener ciertos ribetes de ciencia ficción, lo cierto es que se trata de un escenario posible, Como sabemos la tecnología avanza a pasos gigantes con desarrollos fantásticos como por ejemplo la Inteligencia artificial y los robots, los cuales eventualmente nos reemplazarán en muchas de las tareas que son desarrolladas en la actualidad por humanos.

    Frente a este negro escenario, nada mejor que comenzar a aprender a programar, lo cual nos puede asegurar un futuro prometedor, y quienes no entiendan esto quedarán estancados. Afortunadamente, muchos entienden que este escenario no es una película, y que puede ser perfectamente posible, y lo que es peor, viable.

    Pero fundamentalmente aprender a programar nos asegura bienestar. La informática a ese nivel es un campo en el cual la retribución monetaria es excelente, pero además es mucho más saludable que otros ámbitos, ya que la mayoría de los profesionales del sector trabajan de manera freelance, es decir que no deben presentarse todos los días a trabajar en un ámbito laboral que la mayoría de las veces es nocivo. Estos programadores que dieron este paso trabajan por su cuenta y hacen sus propios horarios, lo que les permite ser dueños de su tiempo y de su salud, tanto mental como física.

    Por todo ello aprender a programar, pero tomándolo de manera seria y con vistas a hacernos u futuro, es una de las alternativas laborales más interesantes con las que contamos, ya que en poco tiempo estaremos completamente computarizados, con lo cual se va a necesitar una legión de programadores para atender toda esa demanda.

    Cómo se programa?

    Al leer los beneficios que puede ofrecer aprender a programar, es bastante probable que nos sintamos con ganas de recorrer ese camino, sin embargo, lo cierto es que la programación no es para nada sencilla, y realmente es para aquellos que realmente quieren aceptar el desafío de comenzar una carrera que implica el conocimiento de múltiples disciplinas del conocimiento.

    Claro está que si tenemos las ganas de comenzar a programar, estos escollos no serán un gran problema. En este punto es necesario aclarar que tampoco aprender cómo se programa implica tener conocimientos de física cuántica o matemáticas muy avanzadas, es sólo cuestión de recurrir a lo aprendido en la escuela, y sumarlo a todos los demás conocimientos que hemos ido adquiriendo a lo largo de nuestra vida. Por supuesto también estudios superiores en programación.

    La programación se puede separar básicamente en dos aspectos claramente diferenciados: El meramente técnico, relacionado con el aprendizaje de los lenguajes de programación, y el aspecto comercial de la actividad, es decir las maneras de posicionarnos mejor para obtener mejores beneficios.

    Aprender a programar es tan sencillo como lo deseemos, en realidad. Podría decirse que programar es ejecutar un software de lenguaje de programación, estructurar una serie de secuencias de acuerdo al tipo de lenguaje que estamos usando y con esto terminaríamos. Si bien esto podría resumirse de esta manera, lo cierto es que un buen programador tiene una base de conocimientos y una responsabilidad con lo que hace que lo separa del resto.

    Estos elementos se adquieren aprendiendo de los errores y aciertos cometidos durante el aprendizaje y el desarrollo laboral, el conocimiento cabal de las herramientas que usa para programar y sobre todas las cosas, estar convencido de tener que hacer las cosas mejor que nadie para poder separarse del resto. Para alcanzar este objetivo, no sólo es necesario capacitarse, sino mantener un profesionalismo que debe marcar la diferencia. Ser programador no sólo implica saber programar, también es necesario llevar adelante una política comercial y de comportamiento.

    Esto permitirá que un programador que se toma en serio las cosas, es decir que se capacita constantemente para ofrecer lo mejor, aprende de su experiencia y tiene una ética de trabajo, siempre podrá conseguir mejores posibilidades de trabajo que los demás, ya que será capaz de pensar más allá de lo estrictamente técnico para brindar la solución perfecta de software para su cliente.

    En este sentido, no le sirve al programador, por ejemplo, copiar y pegar código de otros programadores o sentencias estándar, ya que quizás no se ajuste a los requerimientos del cliente. Un buen programador siempre construirá su propia solución personalizada, con la cual seguramente obtendrá los mejores resultados. Y de la misma manera en todos los escenarios: dar lo mejor de sí para que el cliente quede satisfecho.

    Pero para poder hacer esto es necesario estudiar más allá de lo estrictamente necesario, lamentablemente el camino que muchos toman. Un buen programador siempre estará actualizado en sus conocimientos, estudiará toda la documentación pertinente a cada lenguaje de programación para poder conocerlo a la perfección y obtener la mejor forma de hacer las cosas.

    Básicamente, un buen programador siempre seguirá formándose para poder llevar a cabo su tarea de la mejor forma posible. En este punto, seguir aprendiendo siempre debe ser algo que el programador siempre debe tener en cuenta. Además estudiará otros ámbitos, más relacionados con la atención al cliente como por ejemplo la comunicación, es decir sabe escuchar y entender los que el cliente necesita, y tener la capacidad para poder informarle al cliente lo que hicimos, además el programador siempre debe anteponer las necesidades del cliente a sus propias creencias o posturas.

    Cuántos lenguajes de programación debo aprender?

    La respuesta a esta pregunta es básicamente todos los que existen. Un buen programador debe conocer todas las herramientas disponibles en el mercado para poder evaluar cuál es la que mejor se adapta a un trabajo en particular. Como sabemos, las computadoras y demás dispositivos son ajenos a los lenguajes de programación, ya que no los pueden interpretar directamente, para ello existen otras herramientas como los lenguajes ensambladores y demás que convierten estas secuencias en lenguaje binario, es decir el lenguaje que entienden procesadores y microprocesadores.

    Por este motivo podemos usar un lenguaje de programación específico para una necesidad concreta. En este sentido, los programadores con más experiencia tienen instalados en sus computadoras muchos lenguajes de programación diferentes, y los usan de acuerdo a las necesidades que requiere el trabajo a realizar. Si bien para quien recién se inicia en la programación, lo mejor es aprender un lenguaje de programación flexible y que le permita adaptarlo a múltiples escenarios, con el tiempo será necesario aprender la mayor cantidad de ellos posible, de acuerdo a nuestra especialización.

    Sin embargo aquí no estamos hablando de echarles una ojeada para entender más o menos su funcionamiento. Estamos diciendo que es necesario aprender un lenguaje de programación por completo para poder obtener de ellos las mejores ventajas, y aplicarlos de la mejor manera posible acuerdo al escenario en el que vamos a actuar, lo que nos permitirá tener un mejor rango de acción, y por lo tanto mejores posibilidades laborales.

    Algoritmos, programas y lenguajes de programación

    Muchos estudiantes de informática o programación piensan, sobre todo al principio de sus carreras, que al tratarse de conjuntos de instrucciones, los algoritmos y programas son la misma cosa.

    Sin embargo un algoritmo y un programa son dos cosas bastante diferentes. Un algoritmo podría ejemplificarse como una idea para solucionar un problema plasmada paso por paso, mientras que un programa realiza una serie de instrucciones que han sido desarrolladas a través de un algoritmo.

    Además, un programa de software sólo puede ser ejecutado por un dispositivo electrónico como una computadora o teléfono, ya que se encuentra en lenguaje binario, mientras que un algoritmo, al estar plasmado en un lenguaje entendible por humanos, puede ser ejecutado por una persona. Esas son las principales diferencias.

    El algoritmo, como mencionamos, es un conjunto de instrucciones desarrolladas para solucionar un problema específico. Básicamente es un concepto que puede ser explicado mediante nuestra propia lengua a través de diagramas de flujo, los cuales son una descripción gráfica de un algoritmo utilizando distintas figuras y líneas.

    También es posible explicarlos a través de una técnica en la que es necesario indicar los datos de entrada y de salida y se utilizan instrucciones de ciclo y condicionales del tipo IF, llamada pseudocódigo, básicamente un especie de interlocutor entre nuestro lenguaje natural y un lenguaje de programación.

    En el caso de los programas, software o aplicaciones, como también se les llama, está siempre ligados a la ejecución mediante algún tipo de dispositivo electrónico, ya que al estar en código binario sólo pueden ser entendidos por los procesadores que estos aparatos poseen para interpretar y ejecutar estas instrucciones.

    Ejemplo de algoritmo

    Algoritmo para definir si un triángulo es escaleno, isósceles o equilátero

    Datos de entrada: lado1, lado2, lado3

    Datos de salida: tipo

    si lado1 = lado2 y lado1 = lado3

    entonces

    tipo <- equilatero

    sino

    si (lado1 = lado2) o (lado1 = lado3) o (lado2 = lado3)

    entonces

    tipo <- isósceles

    sino

    tipo <- escaleno

    Ejemplos de programación

    Si estamos dando los primeros pasos en el mundo de la programación, y queremos tener a mano toda la información posible para estar lo mejor preparados que podamos, sin duda alguna una de las primeras cosas por las que tenemos que empezar es a conocer los diferentes lenguajes de programación que existen en el mercado.

    En este sentido, a partir de este punto encontraremos los lenguajes de programación más usados en el mundo, con lo cual podremos tener una orientación acerca de lo que podemos hacer con ellos con el objetivo de saber cuál es el que mejor se adapta a lo que queremos hacer.

    Java

    No cabe ninguna duda que Java es uno de los lenguajes de programación más populares. Lanzado por Sun Microsystems en 1995 es uno de los lenguajes de programación más usados en todo tipo de implementaciones, como por ejemplos diseño web, juegos, aplicaciones para celulares y software de control para cientos de miles de dispositivos, entre otras.

    Java ofrece como ventajas que se trata de un lenguaje de programación multiplataforma, es de código abierto y de distribución gratuita, además de disponer de una amplia librería. Como desventajas para el usuario que recién comienza, podemos citar su sintaxis, bastante compleja, y cierta lentitud debido a que tiene que ser interpretado.

    Ejemplo de programación en Java

    public class Nombre_Clase

    {

    public static void main (String args[])

    {

    //bloque de sentencias;

    }

    }

    JavaScript

    JavaScript es un lenguaje de programación liviano, también multiplataforma y estructurado, su desarrollo es del tipo “orientado a objetos”. Por estos motivos JavaScript es uno de los lenguajes más usados por desarrolladores de sitios web. Como ventajas podemos decir que JavaScript es seguro y fiable, muy completo en características y opciones, y demás muy sencillo de usar, por lo cual es muy apto para todos aquellos que recién se inician en el mundo de la programación. Sin embargo, ofrece ciertas desventajas como ciertas vulnerabilidades relacionadas con la visibilidad de su código, el cual puede ser leído por cualquiera al que le interese.

    Ejemplo de programación en JavaScript

    <!DOCTYPE html>

    <html>

    <head>

    <title>Primer programa</title>

    </head>

    <body>

    <script>

    alert("Abrir ventana de alerta");

    document.write("Enviar contenido al documento HTML");

    </script>

    </body>

    </html>

    C++

    C++ es un lenguaje de programación que permite la manipulación de objetos que fue desarrollado para extender las capacidades de otro lenguaje, “C”. C++ es conocido por desarrolladores como una de las mejores herramientas de programación, debido fundamentalmente a su flexibilidad y potencia.

    Este lenguaje de programación es muy utilizado en el desarrollo de sistemas operativos, bibliotecas y aplicaciones de todo tipo. Además ofrece características como la posibilidad de compilar el código que creamos en múltiples plataformas. Como desventajas podemos citar que es complicado el uso de librerías, así como la gestión de la memoria, que deben ser cuidada por el desarrollador. Asimismo no es un lenguaje que pueda sernos útil para desarrollar apps o páginas web, ni tampoco para desarrollar bases de datos, por lo cual no es la mejor opción para comenzar a programar.

    Ejemplo de programación en C++

    Longitud de la circunferencia = 2*PI*Radio

    Area de la circunferencia = PI*Radio^2

    Volumen de la esfera = (4/3)*PI*Radio^3

    #include <iostream>

    #include <iomanip>

    #include <cmath>

    using namespace std;

    int main(void)

    {

    const float PI = 3.1416;

    float radio;

    cout << "Introducir el valor del radio : ";

    cin >> radio;

    cout << "\nLongitud de la circunferencia: " << fixed << setprecision(2) << 2*PI*radio;

    cout << "\nArea del circulo: " << PI*pow(radio,2);

    cout << "\nVolumen de la esfera: " << (4.0/3)*PI*pow(radio,3) << endl;

    system("pause");

    PHP

    PHP es uno de los lenguajes de programación más usados para el desarrollo web, muy orientado específicamente hacia el desarrollo de apps web dinámicas ya que es posible incrustarlo en el código HTML. Su principal característica es su sencillez de uso, que lo hace un lenguaje de programación más que apto para todos aquellos que se están iniciando en el mundo de la programación.

    Se trata de un lenguaje muy seguro y confiable, debido a que su código fuente se encuentra escondido tanto para el navegador que lo ejecuta como para el cliente. Pero además de la seguridad, PHP es muy flexible, por lo cual puede ser usado tanto por programadores experimentados como por estudiantes que recién comienzan.

    Ejemplo de programación en PHP

    <!DOCTYPE html>

    <html>

    <head>

    <title>Ejemplo</title>

    </head>

    <body>

    <?php

    echo "¡Hola, soy un script de PHP!";

    ?>

    </body>

    </html>

    Si quieres saber más acerca de PHP, puedes conseguir mucha más información en este enlace, que te llevará directamente hacia el sitio oficial de PHP.

    Perl

    Sin duda alguna, junto a JavaScript, Perl es uno de los lenguajes de programación más sencillos que existen. Perl es usado muy asiduamente para el desarrollo de aplicaciones CGI (Common Gateway Interface), la cual básicamente es una tecnología que permite a un navegador web, en este caso llamado cliente, solicitar datos a cualquier proceso ejecutándose en un servidor web. Algunas de las principales características del lenguaje de programación Perl son su extrema eficiencia y muy buen rendimiento.

    Sin embargo Perl, no necesariamente debe usarse únicamente en el ámbito web, ya que también puede ser utilizado para el desarrollo en otros entornos. Algunas de las desventajas de Perl son que puede resultar lento en comparación con otras herramientas de desarrollo, sin embargo esto se debe a que el código es compilado al principio de la ejecución. También su código puede ser difícil de leer, y en muchas ocasiones, es muy complicado encontrar y asilar errores para pulir el programa.

    Ejemplo de programación en Perl

    #!/usr/bin/perl -w

    # Storing DNA in a variable, and printing it out

    # First we store the DNA in a variable called $DNA

    $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';

    # Next, we print the DNA onto the screen

    print $DNA;

    # Finally, we'll specifically tell the program to exit.

    exit;

    Python

    Python es un lenguaje de programación orientado a objetos muy utilizado para desarrollar todo tipo de aplicaciones y juegos tanto para la web como para el escritorio. Es multiplataforma, de distribución libre y realmente muy flexible.

    Con respecto a las ventajas de Python podemos mencionar que se integra muy bien con otros lenguajes de programación como Java, C o C++, entre otros. Podríamos mencionar como desventajas que no hay suficiente documentación, algo muy necesario e importante sobre todo para los usuarios que recién comienzan en el mundo de la programación.

    Ejemplo de programación en Python

    # Ejercicio 1

    print(Juan)

    print('Cumpleaños: 11 de febrero)

    edad = 30

    print('Tengo', edad, 'años')

    actor = 'Brad Pitt'

    comida = 'Asado'

    ciudad = 'Buenos Aires'

    print('Me gustan las películas de', actor)

    print('Me gusta cenar', comida)

    print('Vivo en', ciudad)

    Tipos de programación

    En la actualidad existen varias formas de encarar la programación de un software, los cuales dependerán a su vez del lenguaje o la técnica utilizada. Estos se denominan tipos de programación, y tenemos varios a nuestra disposición, los cuales podemos usar de acuerdo al proyecto en el que trabajamos. Si bien en casi todos los casos la técnica más usada es la de la programación modular o estructurada, existen algunos tipos más, de los cuales hablaremos a continuación.

    Estos tipos de programación son:

    • Programación estructurada
    • Programación modular
    • Programación lineal
    • Programación orientada a objetos
    • Programación concurrente
    • Programación funcional
    • Programación lógica

    A partir de este punto, conoceremos con más profundidad a cada uno de estos tipos de programación.

    Los diferentes tipos de Programación

    Programación estructurada

    La programación estructurada es básicamente un conjunto de técnicas que le permiten sin duda alguna al programador tener un flujo de trabajo mucho más rápido y efectivo. En la programación estructurada, el software desarrollado es más sencillo de entender, no es necesario que el testeo sea tan complejo. Asimismo, el código de los programas queda mucho mejor ordenado y documentado.

    Estas técnicas mejoran en mucho la performance final del producto ya que no es necesario tanto tiempo de depuración y mantenimiento. Parte de estas técnicas implica utilizar un número menor de estructuras de control, lo que permite reducir muchos de los errores de software que se producirían de otro modo.

    Los diferentes tipos de Programación

    Otras técnicas utilizadas en la programación estructurada son

    • Diseño descendente (top-dow)
    • Recursos abstractos
    • Las estructuras básicas, de las cuales existen tres tipos: Estructuras secuenciales, Estructuras selectivas y Estructuras repetitivas

    Programación modular

    Otro de los tipos conocidos de programación es la llamada programación modular, la cual básicamente se trata de  un paradigma de programación. Para entender lo que es programar utilizando la programación modular, es dividir un programa en módulos o subprogramas más específicos. Este tipo de programación fue desarrollado con el objetivo principal de poder obtener un código mucho más legible y manipulable.

    En este tipo de programación, el programa principal es la parte encargada de coordinar las llamadas a los módulos secundarios. Luego de ello pasa los datos necesarios en forma de parámetros. Cabe destacar que cada módulo es capaz de contener sus propios datos y llamar a otros módulos o funciones.

    Los diferentes tipos de Programación

    Todo esto significa que cuando aplicamos programación modular, cualquier programa complejo puede ser subdividido en muchas partes. Es decir que un programa grande puede ser dividido en partes más pequeñas. Esto ofrece múltiples ventajas a la hora de encontrar errores o modificar parte del código.

    Funcionamiento básico de la programación modular

    • Entrada: Parámetro
    • Proceso: Subrutina o función
    • Salida: Valor de retorno

    Programación lineal

    En el ámbito de la programación se conoce como programación lineal a una técnica de la matemática que permite la optimización o minimización de una función lineal objetivo. Esto se hace con el propósito de que las variables de la mencionada función queden atadas a una determinada serie de restricciones. Estas restricciones se expresan mediante un sistema de ecuaciones o inecuaciones también lineales.

    Los diferentes tipos de Programación

    En los modelos de programación lineal se establece que las variables de decisión como la función objetivo y las restricciones, se correspondan con un comportamiento de tipo lineal. Con esto se consigue facilitar los cálculos y conseguir resultados más cercanos a los reales.

    El modelo más comúnmente usado para resolver problemas de programación lineal es el llamado “Método Simplex”.

    Programación orientada a objetos

    La programación orientada a objetos es básicamente una técnica capaz de mejorar en términos de velocidad y solidez el desarrollo de software. Esta mejora en el desarrollo se debe a la reutilización de los objetos que ya se encuentran cargados en el programa.

    Como podemos dilucidar, el principal elemento de la POO es el objeto, el cual básicamente se trata de un set de datos y programas. Estos poseen estructura y forman parte de una organización mayor. Estos objetos son capaces de contener variados tipos de datos, todos ellos estructurados. Estos pueden ser visibles o no visibles de acuerdo a las necesidades propias del programador y del software.

    Los diferentes tipos de Programación

    Algunas de las principales características de la programación orientada a objetos son el polimorfismo y la herencia.

    Programación concurrente

    En el ámbito del desarrollo de software, la programación concurrente es un tipo de programación realmente muy usada. Es utilizada por el desarrollador cuando requiere llevar a cabo múltiples tareas en forma simultánea. Entre las tareas que se puede llevar a cabo se encuentran la posibilidad de controlar el acceso de múltiples usuarios a sistemas y software.

    Si bien se trata de un tipo de programación mucho más complicado, lo cierto es que si se lleva a cabo con acierto, los resultados que se obtienen son superiores. Es decir que implementado esta técnica se puede mejorar significativamente la performance del software que se está desarrollando. Esto es debido a que en la programación concurrente las tareas pueden desarrollarse sin tener que esperar un turno de ejecución.

    Los diferentes tipos de Programación

    Sin embargo, la programación concurrente también puede ofrecer ciertos puntos desfavorables. Un ejemplo de ello se produce cuando tenemos la necesidad de compartir información entre tareas, pero como mencionamos, bien implementado puede ser una excelente ventaja en muchos entornos.

    Programación funcional

    Al igual que la programación modular, la programación funcional es un paradigma de programación, lo que significa que se trata de una vía de resolver problemas de programación. Cuando un desarrollador utiliza este paradigma, trabaja principalmente con funciones, evitando todo tipo de datos variables, además de impedir que se compartan estados entre funciones.

    En la programación funcional todas las funciones son tratadas como “ciudadanos” de primera clase. Dichas funciones pueden ser asignadas a variables, las que a su vez podrán ser utilizadas como entrada y salida de muchas otras funciones. A todas aquellas funciones que sean capaces de tomar funciones como parámetros y devolver funciones como resultado, se consideran funciones de orden superior.

    Los diferentes tipos de Programación

    Básicamente, la premisa es que la programación funcional es lo  que los expertos consideran “paradigma declarativo”. Esto es así debido a que el programador se centra en el “Qué” está haciendo y no en el “Cómo”, lo cual sería considerado como un “enfoque imperativo”.

    Todo esto significa que el programador expresará su lógica sin necesidad de descripciones de control de flujo, es decir que no utilizaremos ni ciclos ni condicionales.

    Programación lógica

    Podríamos decir que la programación lógica es un tipo de paradigmas de programación dentro del paradigma de programación declarativa. En la actualidad este tipo de programación es muy usado en el desarrollo de inteligencia artificial. Que es programar con programación lógica? Es utilizar una metodología basada en el cálculo de predicados, la cual es una teoría matemática. Con esta teoría se consigue que una computadora puede dar soluciones mediante el uso de reglas y hechos lógicos.

    Los diferentes tipos de Programación

    En este sentido, la programación lógica tiene para ofrecer herramientas de programación únicas de este paradigma, que permite desarrollar IA de manera más flexible. En este sentido, en la actualidad la mayoría de las aplicaciones de inteligencia artificial se desarrollan en este lenguaje por ese motivo. Esto es debido fundamentalmente a que la programación lógica es muy diferente en su modo de pensar a la forma en que pensamos en los lenguajes de programación más comunes. Básicamente, lo que intenta duplicar la programación lógica es al pensamiento humano, por consiguiente, es más natural organizar pensamientos de este modo que con lenguajes tradicionales. Esto sin embargo requiere de un mayor nivel de abstracción.

    En la programación lógica, no se piensa en estructuras de bajo nivel tales como asignaciones y repeticiones, sino en términos de premisas y conclusiones, llegando a la resolución de problemas mediante un conjunto de axiomas lógicos.

    Graciela Marker

    Periodista independiente con más de 20 años de experiencia en medios gráficos, audiovisuales y digitales. Formada académicamente en periodismo digital y comunicación multimedia, ámbito en el que se desenvuelve hace dos décadas. Especializada en ámbitos tales como la informática y la logística empresarial, entre otros.

    1. Harling Jimenez Charris dice:

      Excelente articulos. Los felicito por excelentes articulos que hacen.

    Deja una respuesta

    Tu dirección de correo electrónico no será publicada. Los campos obligatorios están marcados con *

    Subir

    Usamos cookies para darte una mejor experiencia de navegación. Si continuas navegando, aceptas su uso. Más Información sobre nuestras Cookies